Journal: Frontiers in Immunology

Article Title: Allograft Inflammatory Factor-1 Governs Hematopoietic Stem Cell Differentiation Into cDC1 and Monocyte-Derived Dendritic Cells Through IRF8 and RelB in vitro

doi: 10.3389/fimmu.2019.00173

Figure Lengend Snippet: Absence of AIF1 restrains hematopoietic progenitor differentiation into cDC1 lineage commitment. Bone marrow cells were harvested and silenced for AIF1 by CRISPR RNAi approaches prior to differentiation into DC using Flt3-L as stimuli for 9 days. CRISPR Cas9 plasmids with either gRNA targeting AIF1 (pAIF1) or non-targeting scrambled gRNA (pControl) were used to transfect the cells. Cells were collected and stained with respective antibodies and Live/Dead viability dye to discriminate and gate on the Live + population. (A) To assess common myeloid progenitor (CMP) profiles, dot plots show SCA1 expression in cells gated on Live + Lin − CD117 + FcγR − CD34 + subset. (B) CD11b vs PDCA1 was utilized to assess pDC, where pDC are CD11b-PDCA1 + . (C) cDC profile shows CD11c vs. MHC class II gated on total Live + cells. CD24 vs CD172a were evaluated on the gated CD11c + MHC class II + subsets. Next, cells were assessed for Zbtb46 vs. IRF4 or IRF8. (D) Real-time PCR analysis was performed on control or AIF1 silenced group to assess AIF1, PU.1, Id2, Zbtb46, IRF4, IRF8, BATF3, RelB, and CIITA. Data is representative of six independent experiments. Error bars for all figures indicate standard errors; ** < 0.01 and NS, not significant.

Article Snippet: Two CRISPR DNA plasmids were created using the GeneArt CRISPR Nuclease Vector Kit (Thermo Fisher) to target AIF1.

Techniques: CRISPR, Staining, Expressing, Real-time Polymerase Chain Reaction, Control

Journal: Cell reports

Article Title: Sterols lower energetic barriers of membrane bending and fission necessary for efficient clathrin-mediated endocytosis

doi: 10.1016/j.celrep.2021.110008

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Briefly, a guide RNA (5′-GCAGATGTAGTGTTTCCACA-3′) targeting the open reading frame in the immediate vicinity of the stop codon was cloned into the Cas9 expression vector pX330-U6-Chimeric_BB-CBh-hSpCas9 (gift from Feng Zhang; ), Addgene plasmid #42230).

Techniques: Derivative Assay, Recombinant, Electron Microscopy, Transfection, Expressing, Plasmid Preparation, Software, Cell Analysis, Gas Chromatography, Mass Spectrometry

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) Forest plots depicting RNA and IHC-based for ZFP36 /TTP expression related to clinical outcomes (biochemical recurrence and disease-free survival) and risk of lethal prostate cancer (case-control cohorts). (B) (left) Upregulated and downregulated genes were identified by differential expression analysis of TCGA PRAD cases divided by lower quartile expression of ZFP36 ; (right). (C) Representative images of IF staining in human PCa used for expression analysis. Benign glands (arrowheads) stain for pan-cytokeratin (yellow) and basal (red) cocktails; tumor cells (arrows) demonstrate absent basal expression (panels ii & iv). Corresponding sections (i & iii) demonstrate intact epithelial staining for TTP (green). Panels v-vi: Diffuse prostate tumor with absent TTP expression. (D) Kaplan Meier survival analysis demonstrating that TTP deficiency, measured by protein expression (DFCI ( , )) and ZFP36 mRNA expression (TCGA PRAD ; Taylor et al ), results in shorter disease-free-survival, and even shorter disease-free-survival in combination with PTEN deficiency.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Expressing, Control, Quantitative Proteomics, Staining

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) hematoxylin and eosin staining of murine tumors highlighting morphological progression of wild-type (WT), Pten f/f / Zfp36 +/+ ( Pten -/-), Pten f/f / Zfp36 f/+ ( Pten -/- Zfp36 +/-) and Pten f/f / Zfp36 f/+ ( Pten -/- Zfp36 -/-) dorsolateral prostate tissue at 8 18, and 38 weeks. Scale bar 100 μm. (B) Comparative weight of dorsolateral and ventral prostate tissue in GEMMs at 18 and 38 weeks. (C) Kaplan Meier graphs from GEMM aging studies show that prostate-specific deletion of Zfp36 significantly reduces time-to-ethical endpoint in PCa driven by loss of Pten. *p<0.05, **p<0.005.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Staining

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) GSEA from RNA-seq of endpoint GEMM PCa tumors comparing Pten -/-, and Pten -/- Zfp36 -/- GEMMs, highlighting positively and negatively enriched Hallmark pathways. (B) Phos-p65 IF and Masson’s Trichrome staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bar 100 μm. *p<0.05, **p<0.005.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: RNA Sequencing, Staining

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) GSEA from RNA-seq of endpoint GEMM PCa tumors comparing Pten -/-, and Pten -/- Zfp36 -/- GEMMs, highlighting significant positively and negatively enriched GOBP pathways. (B) Ki-67 IHC, and Krt18 and αSMA IF staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Increased tumor cell proliferation and basement membrane breakdown is observed with loss of Zfp36 . (C) Number of mice that displayed PCa cells in distant organs by recombination PCR in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMMs. (D) Representative androgen receptor (AR) IF staining in pelvic lymph nodes of Pten -/- and Pten -/- Zfp36 -/- GEMMs highlighting local dissemination of prostate cells. Scale bar 100 μm. AR staining was over exposed during imaging to assist with prostate cell identification. (E) Representative images and quantification of budding in GEMM-derived organoids highlighting increased invasive and metastatic potential of Pten -/- Zfp36 -/-organoids. (F) Scratch assay in GEMM-derived 2D cells, comparing Pten -/- and Pten -/- Zfp36 -/- wound healing with that of Pten -/- Rb1 -/-, a previously described metastatic, neuroendocrine PCa murine cell line . *p<0.05, **p<0.005, ***p<0.001, ****p<0.0001.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: RNA Sequencing, Staining, Membrane, Imaging, Derivative Assay, Wound Healing Assay

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) AR, synaptophysin (Syp) and CD45 IF staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bar 100 μm. *p<0.05, **p<0.005. (B) Dual Krt8 and CD45 IF staining in Pten -/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks. Scale bar 50 μm.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Staining

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) Kaplan Meier graph from GEMM aging studies where mice were surgically castrated at 38 weeks comparing Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- mice, and whole prostate weights and representative images from mice 12 weeks post-castration. (B) Quantification of GEMM-derived Pten -/- and Pten -/- Zfp36 -/- organoid growth in the presence and absence of enzalutamide (10 μM). (C) Allograft tumor growth in mice treated with DMAPT (100 mg/kg/day) or water vehicle ± surgical castration, n=5 mice per treatment group. (D) End-point tumor volumes from allograft therapy studies. (E) Representative images and (F) quantification of cell death (green) in GEMM-derived PCa organoids treated with DMAPT (5 μM), enzalutamide (10 μM) or the combination of both for 72 hours, n=10 organoids per treatment group. (G) Representative images and flow cytometry quantification for CD45, synaptophysin, and AR expression in GEMM-derived PCa organoids treated with DMAPT (5 μM) or DMSO vehicle for 72 hours. (H) Fold-change in expression of the AR response gene – Fkbp5 in GEMM-derived 2D cell lines treated with DMAPT (5 μM) or DMSO vehicle for 72 hours, R1881 (10nM was used to stimulate AR activity. *p<0.05, **p<0.005, ***p<0.001. (I) Schematic overview: i) when ZFP36 is intact epithelial cells present with a luminal lineage phenotype and sensitivity to AR inhibition. ii) loss of ZFP36 results in an alternative epithelial cell lineage phenotype with reduced AR expression, increased SYP and CD45 expression, and increased NF-κB activation and inflammation, leading to lack of response to AR inhibition. iii) DMAPT treatment inhibits NF-κB and inflammation signaling and restores a more luminal epithelial cell type and responsiveness to AR inhibition.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Derivative Assay, Flow Cytometry, Expressing, Activity Assay, Inhibition, Activation Assay

Journal: Cell stem cell

Article Title: Zika Virus Targets Glioblastoma Stem Cells through a SOX2-Integrin α v β 5 Axis

doi: 10.1016/j.stem.2019.11.016

Figure Lengend Snippet: (A) Representative immunostaining for ZIKV envelope protein (ZIKV-E, green) and DAPI (blue) of GSCs and forebrain-specific NPCs 48 h post-infection (p.i.) with ZIKV. Scale bar, 50 μm. (B) Quantification of infection efficiency in four GSC and NPC lines 48 h p.i. with ZIKV. (C) Quantification of ZIKV+ cells in a panel of human GSCs and NPCs. (D) Kinetics of viral RNA copies p.i. with ZIKV by measuring viral RNA copies by qRT-PCR in NPC C4–7 and GSC3565. (E) ZIKV infection efficiency of GSCs and NPCs was measured by direct measurement of viral RNA copies. (F) Representative bright-field images 5 days p.i. with ZIKV for GSCs, NPCs, and primary astrocytes. Scale bars, 50 μm. (G) Cell viability normalized to day 5 mock, as measured 5 days p.i. with ZIKV for GSCs, NPCs, and primary astrocytes. (H) GSCs (GSC3565), differentiated GSCs, NPCs (NPC C4–7), and differentiated NPCs were assayed for cell viability 72 h p.i. with ZIKV. (I) Apoptosis of GSCs (387, 3565) and primary (NPC194, fetal human [fh] NPC) or iPSC-derived NPCs (WT83, C4–7) p.i. with ZIKV was measured by cleaved caspase-3 (CC3) staining. (J) Representative immunostaining for ZIKV-E (green), CC3 (red), and DAPI (blue) of GSCs and forebrain-specific NPCs 48 h p.i. with ZIKV. Scale bar, 50 μm. (K) Representative immunostaining for ZIKV-E (green), CC3 (red), and DAPI (blue) of GSCs and forebrain-specific NPCs 72 h p.i. with ZIKV. Scale bars, 50 μm. (L) Quantification of the percentage of CC3+ cells in DAPI+ cells for GSCs and NPCs 72 h p.i. with ZIKV. (M) Cell viability of patient-derived cultures from GBM (387 and 3565), pontine glioma (3752 and 007), meningioma (CH-157MN, IOMM-LEE), ependymoma (EP1), and medulloblastoma cell lines (DAOY, D283, HDMB03, D341) 72 h after ZIKV infection. Experiments were performed in two biological replicates with three technical repeats. Values represent mean ± SEM. NS, no significance. ****p < 0.0001 by one-way ANOVA.

Article Snippet: After 30 minutes, the reaction cocktail was removed, cells were washed once with 1 mL of 3% BSA in PBS before proceeding to DNA staining (DAPI, Vector Laboratories H-1200) and imaging (Zeiss Apotome). . ZIKV preparation ZIKV human isolates H/PAN/2016/BEI-259634 and PRVABC59 (BEI Resources, NR-50210 and NR-50240) from Panama and Puerto Rico, respectively, were acquired from the ATCC and distributed by BEI.

Techniques: Immunostaining, Infection, Quantitative RT-PCR, Derivative Assay, Staining

Journal: Cell stem cell

Article Title: Zika Virus Targets Glioblastoma Stem Cells through a SOX2-Integrin α v β 5 Axis

doi: 10.1016/j.stem.2019.11.016

Figure Lengend Snippet: (A) Representative immunostaining for ZIKV-E (green), SOX2 (red), and DAPI (blue) of GSCs and forebrain-specific hiPSC-derived NPCs 48 h p.i. with ZIKV. Scale bar, 50 μm. (B) Quantification of the percentage of SOX2+ cells in DAPI+ cells for GSCs and NPCs 48 h p.i. with ZIKV. (C) Representative immunostaining for ZIKV-E (green), SOX2 or AXL (red), and DAPI (blue) of GSCs (GSC3565) without transduction (shRNA) or transduced with control shRNA (shCONT), AXL shRNA (shAXL.2), or SOX2 shRNA (shSOX2.53) for 72 h and then 48 h with ZIKV infection. Scale bars, 100 μm. (D) Quantification of the percentage of ZIKV+ cells in DAPI+ cells in GSCs 1517 and 3565 under conditions for (C), with a range of ZIKV infection. (E) Viral copy number by qRT-PCR of GSCs (GSC3565 or GSC1517) or NPC C4–7 transduced with either shCONT or SOX2 shRNA (shSOX2.52 or shSOX2.53) for 72 h and then either exposed to mock conditions or infected with ZIKV for another 72 h. All comparisons are versus shCONT. (F) Gene set enrichment (GSE) bubble plots showing pathways positively (top, r > 0.4) or negatively (bottom, r < −0.4) correlated with SOX2 expression in the TCGA GBM HG-U133A microarray dataset. Each circle represents an enriched pathway, with the border color indicating the false discovery rate (FDR)-corrected p value. (G) GSE graph showing the top pathway enrichments positively or negatively correlated with SOX2 as described in (F). (H) Correlation of mRNA levels of SOX2 with IFNAR1, IRF1, promyelocytic leukemia (PML), and IFITIM1 from the TCGA GBM HG-U133A microarray dataset. (I) Correlation between SOX2 with ISGs from the TCGA GBM HG-U133A microarray dataset. The size and color of the dots indicate the degree of correlation (p < 0.001). Blank cells indicate a non-significant correlation. (J) qPCR of ISGs (IFNAR-1, ISH20, IRF1, IFITM1, TLR3, and OAS2) in GSCs (GSC3565) transduced with either shCONT or SOX2 shRNA (shSOX2.52 or shSOX2.53). Experiments were performed in two biological replicates with three technical repeats. Values represent mean ± SEM. **p < 0.001, ****p < 0.0001 by one-way ANOVA.

Article Snippet: After 30 minutes, the reaction cocktail was removed, cells were washed once with 1 mL of 3% BSA in PBS before proceeding to DNA staining (DAPI, Vector Laboratories H-1200) and imaging (Zeiss Apotome). . ZIKV preparation ZIKV human isolates H/PAN/2016/BEI-259634 and PRVABC59 (BEI Resources, NR-50210 and NR-50240) from Panama and Puerto Rico, respectively, were acquired from the ATCC and distributed by BEI.

Techniques: Immunostaining, Derivative Assay, Transduction, shRNA, Control, Infection, Quantitative RT-PCR, Expressing, Microarray

Journal: Cell stem cell

Article Title: Zika Virus Targets Glioblastoma Stem Cells through a SOX2-Integrin α v β 5 Axis

doi: 10.1016/j.stem.2019.11.016

Figure Lengend Snippet: (A) Representative images of mock- or ZIKV-infected BCOs stained with neuronal markers (CTIP2 and NeuN), a neural progenitor cell marker (SOX2), and DAPI. Scale bars, 100 μm. (B) Quantification of BCO size p.i. with ZIKV. Significance was assessed by two-tailed Student’s t test, and experiments were performed in two batches with 12 organoids per group per batch. (C) BCO size fold change of ZIKV- and mock-treated groups over a period of 1 month. (D) Quantification of SOX2+ cells in ZIKV- versus mock-infected groups. *p < 0.05 by two-tailed Student’s t test. (E) Quantification of CC3+ cells in ZIKV- versus mock-infected groups. *p < 0.05 by two-tailed Student’s t test. (F) Quantification of SATB2+ cells within MAP2+ cells in ZIKV- versus mock-infected groups. **p < 0.01 by two-tailed Student’s t test. (G) Quantification of GFAP+ cells in ZIKV- versus mock-infected groups. N.S., not significant by two-tailed Student’s t test. (H) Quantification of NeuN+ cells in ZIKV- versus mock-infected groups. N.S., not significant by two-tailed Student’s t test. (I) Quantification of CTIP2+ cells in ZIKV- versus mock-infected groups. N.S., not significant by two-tailed Student’s t test. (J) Bright-field images of engraftment of two patient-derived GSCs (387 and 3565) transduced with GFP into human BCOs over a time course. Scale bars, 1 mm. (K) Engrafted GSCs (GFP+) with normal BCO immunostained for integrin αvβ5 (red), GFP (green), and DAPI (blue). Scale bars, 200 μm. (L) Quantification of integrin αvβ5+ cells in normal BCOs or GSC-BCOs. Values represent mean ± SEM. n = 6. ****p < 0.0001 by two-tailed Student’s t test. (M) Representative images of GFP-labeled GSC-BCOs immunostained for integrin αvβ5 (red), GFP (green), and DAPI (blue). Scale bars, 100 μm. (N) Representative images of GFP-labeled GSC-BCOs immunostained for SOX2 (red), GFP (green), and DAPI (blue). Scale bars, 100 μm. (O) Images of GFP-labeled GSC-GFP BCOs 13 days p.i. with ZIKV. Scale bars, 1 mm. (P) Representative images of residual GSCs (green) and DAPI staining (blue) of GFP-labeled GSC-GFP BCOs cultured under mock conditions or with ZIKV for 2–4 weeks. Scale bars, 200 μm. The percentage of GFP+ cells among DAPI+ cells was quantified. Values represent mean ± SEM. n = 6. ****p < 0.0001 by two-way ANOVA. (Q) Representative immunostaining for integrin αvβ5 (red), GFP (green), ZIKV-E (white), and DAPI (blue) of GFP-labeled GSC-GFP BCOs mock- or ZIKV-infected for 2–4 weeks. Scale bars, 200 μm (left) and 100 μm (center). The percentage of ZIKV-E+ cells among integrin αvβ5 cells was quantified. Values represent mean ± SEM. n = 6. ****p < 0.0001 by two-tailed Student’s t test. (R) Representative images of 387 and 3565 GSC-BCOs with or without ZIKV, respectively, stained with SOX2, ZIKV-E, and DAPI. GFP shows the presence of GSCs (scale bars, 50 μm). ZIKV-E+, GFP+, and ZIKV-E+ cells among GFP+ cells were quantified by counting (two GSCs cell lines, two repeats, n = 12 organoids/group); *p < 0.05 by two-tailed Student’s t test. (S) Schematic of the experiment design. (T) Volcano plot showing differences between GSC-BCO ZIKV versus GSC-BCO mock. 113 genes were differentially expressed (greater than 1.5-fold) between these two groups (*p < 0.05). (U) Network analysis of genes differentially expressed upon ZIKV infection, represented as a bubble plot.

Article Snippet: After 30 minutes, the reaction cocktail was removed, cells were washed once with 1 mL of 3% BSA in PBS before proceeding to DNA staining (DAPI, Vector Laboratories H-1200) and imaging (Zeiss Apotome). . ZIKV preparation ZIKV human isolates H/PAN/2016/BEI-259634 and PRVABC59 (BEI Resources, NR-50210 and NR-50240) from Panama and Puerto Rico, respectively, were acquired from the ATCC and distributed by BEI.

Techniques: Infection, Staining, Marker, Two Tailed Test, Derivative Assay, Transduction, Labeling, Cell Culture, Immunostaining

Journal: Cell stem cell

Article Title: Zika Virus Targets Glioblastoma Stem Cells through a SOX2-Integrin α v β 5 Axis

doi: 10.1016/j.stem.2019.11.016

Figure Lengend Snippet: (A) Immunostaining of the subventricular zone (SVZ) of mice 72 h following ZIKV infection ZIKV-E (green), SOX2 (red, top panels), and integrin αvβ5 (red, bottom panels). Scale bars, 50 μm. (B) Higher magnification of images from (A), demonstrating ZIKV infection of SOX2+ (top panels) and integrin αvβ5+ cells. Scale bars, 10 μm. (C) Survival of ZIKV-infected NSG mice from (A) was plotted by the Kaplan-Meier method. (D) ZIKV-infected brains from the mice in (A) were collected upon death, and histology was assessed by H&E staining. Scale bars, 20 μm. (E) Survival of NSG mice following implantation of GSCs treated with isotype control, P1F6 antibody, ZIKV, combined P1F6 and ZIKV, combined CRISPR knockout (KO) of integrin β5 (sgRNA1 sgRNA2) with ZIKV inoculation, analyzed by log rank test; p < 0.01. (F) H&E staining of tumor-bearing brains from (E). Scale bars, 50 μm. (G) Intraoperative brain slices from GBM patients were pre-incubated with an IgG control antibody or an integrin-blocking antibody under mock conditions or upon ZIKV infection (10e3 FFU). Slices then underwent immunofluorescence staining for ZIKV-E (green), integrin αvβ5 (red), and DAPI (blue). Scale bars, 10 μm. (H) Intraoperative brain slices from GBM patients were pre-incubated with an IgG control antibody or an integrin-blocking antibody under mock conditions or upon ZIKV infection. Slices then underwent a viral RNA copy assay by qRT-PCR. Experiments were performed in two biological replicates with three technical repeats. Values represent mean ± SEM. ****p < 0.0001 by one-way ANOVA.

Article Snippet: After 30 minutes, the reaction cocktail was removed, cells were washed once with 1 mL of 3% BSA in PBS before proceeding to DNA staining (DAPI, Vector Laboratories H-1200) and imaging (Zeiss Apotome). . ZIKV preparation ZIKV human isolates H/PAN/2016/BEI-259634 and PRVABC59 (BEI Resources, NR-50210 and NR-50240) from Panama and Puerto Rico, respectively, were acquired from the ATCC and distributed by BEI.

Techniques: Immunostaining, Infection, Staining, Control, CRISPR, Knock-Out, Incubation, Blocking Assay, Immunofluorescence, Quantitative RT-PCR